| --- Log opened Thu Aug 16 00:00:17 2012 | ||
| @sonney2k | no | 00:04 |
|---|---|---|
| gsomix | good book about 3 generations of programmers: MIT (1950-1960), hardware engineers, game developers and... Stallman. | 00:11 |
| gsomix | sonney2k, ta-dam | 00:17 |
| gsomix | aww, author is Levy | 00:20 |
| gsomix | sonney2k, http://pastebin.com/KJSLiR1L http://pastebin.com/WvuqCCqM | 00:27 |
| gsomix | is it what we wanted? | 00:27 |
| gsomix | ok, I need clean up my code and sleep | 00:34 |
| gsomix | z-z-z-z | 00:34 |
| -!- gsomix [~gsomix@109.169.131.21] has quit [Ping timeout: 252 seconds] | 00:42 | |
| -!- zxtx [~zv@c-67-170-78-150.hsd1.wa.comcast.net] has quit [Ping timeout: 272 seconds] | 01:16 | |
| -!- zxtx [~zv@173-160-235-41-Washington.hfc.comcastbusiness.net] has joined #shogun | 02:02 | |
| shogun-buildbot | build #56 of nightly_none is complete: Failure [failed git] Build details are at http://www.shogun-toolbox.org/buildbot/builders/nightly_none/builds/56 | 03:01 |
| shogun-buildbot | build #65 of nightly_default is complete: Failure [failed git] Build details are at http://www.shogun-toolbox.org/buildbot/builders/nightly_default/builds/65 | 03:02 |
| shogun-buildbot | build #52 of nightly_all is complete: Failure [failed git] Build details are at http://www.shogun-toolbox.org/buildbot/builders/nightly_all/builds/52 | 03:03 |
| -!- zxtx [~zv@173-160-235-41-Washington.hfc.comcastbusiness.net] has quit [Ping timeout: 246 seconds] | 03:30 | |
| -!- puffin444 [62e3926e@gateway/web/freenode/ip.98.227.146.110] has joined #shogun | 04:25 | |
| puffin444 | hey wiking | 04:25 |
| puffin444 | octopine? | 04:29 |
| -!- puffin444 [62e3926e@gateway/web/freenode/ip.98.227.146.110] has quit [Ping timeout: 245 seconds] | 04:50 | |
| -!- shogun-buildbot_ [~shogun-bu@7nn.de] has joined #shogun | 05:26 | |
| -!- shogun-buildbot [~shogun-bu@7nn.de] has quit [Ping timeout: 268 seconds] | 05:27 | |
| octopine | howdy | 06:49 |
| -!- shelhamer [~shelhamer@c-67-169-97-47.hsd1.ca.comcast.net] has joined #shogun | 08:54 | |
| -!- uricamic [~uricamic@2001:718:2:1634:876:e01f:ab62:a2a] has joined #shogun | 08:54 | |
| -!- shelhamer [~shelhamer@c-67-169-97-47.hsd1.ca.comcast.net] has quit [Client Quit] | 08:54 | |
| -!- gsomix [~gsomix@109.169.131.21] has joined #shogun | 08:56 | |
| wiking | yo | 09:25 |
| -!- heiko1 [~heiko@host86-185-9-87.range86-185.btcentralplus.com] has joined #shogun | 09:59 | |
| -!- heiko1 [~heiko@host86-185-9-87.range86-185.btcentralplus.com] has left #shogun [] | 10:01 | |
| gsomix | good morning | 10:22 |
| -!- heiko1 [~heiko@host86-185-9-87.range86-185.btcentralplus.com] has joined #shogun | 10:27 | |
| -!- heiko1 [~heiko@host86-185-9-87.range86-185.btcentralplus.com] has left #shogun [] | 10:27 | |
| -!- gsomix_ [~gsomix@95.67.191.15] has joined #shogun | 11:12 | |
| -!- gsomix [~gsomix@109.169.131.21] has quit [Ping timeout: 244 seconds] | 11:15 | |
| -!- blackburn [~blackburn@62.106.106.114] has joined #shogun | 11:41 | |
| -!- nicococo [~nico@lacedcoffee.ml.tu-berlin.de] has joined #shogun | 11:52 | |
| -!- nicococo [~nico@lacedcoffee.ml.tu-berlin.de] has left #shogun [] | 12:02 | |
| @sonney2k | gsomix_, so you make the zero copy optional right? | 12:28 |
| @sonney2k | because one still has to use frombuffer() ? | 12:29 |
| gsomix_ | sonney2k, yep. I did not figure out, how overload constructor, so there is frombuffer method. | 12:32 |
| CIA-21 | shogun: Soeren Sonnenburg master * r63c8091 / (data doc/tutorial): require current data / doc - http://git.io/UYfhIg | 12:33 |
| gsomix_ | sonney2k, btw, maybe do you know, how raise exceptions in python c/api? | 12:33 |
| @sonney2k | gsomix_, IIRC you have to return some empty python object (and incref it ... IIRC PyNone or so?) | 12:34 |
| @sonney2k | and set the error message | 12:35 |
| @sonney2k | gsomix_, the static python interface should have that code | 12:35 |
| gsomix_ | thanks | 12:35 |
| @sonney2k | gsomix_, instead of frombuffer you could just modify the typemaps | 12:35 |
| shogun-buildbot_ | build #348 of deb1 - libshogun is complete: Success [build successful] Build details are at http://www.shogun-toolbox.org/buildbot/builders/deb1%20-%20libshogun/builds/348 | 12:36 |
| @sonney2k | gsomix_, or is this even possible? I mean do you need access to the underlying SGObject? | 12:36 |
| gsomix_ | sonney2k, no, I don't. | 12:37 |
| wiking | meeting :D | 12:37 |
| gsomix_ | >> you could just modify the typemaps || and constructor. I want something like in numpy - DenseFeatures(array, copy=True/False). | 12:38 |
| shogun-buildbot_ | build #287 of deb2 - static_interfaces is complete: Failure [failed test cmdline_static] Build details are at http://www.shogun-toolbox.org/buildbot/builders/deb2%20-%20static_interfaces/builds/287 blamelist: Soeren Sonnenburg <sonne@debian.org> | 12:38 |
| @sonney2k | gsomix_, yeah that would be cool ... | 12:39 |
| blackburn | wtf | 12:39 |
| blackburn | I fixeed that | 12:40 |
| blackburn | ahhhh | 12:40 |
| @sonney2k | blackburn, no idea - looks like recent commits broke even the standard git submodule update process | 12:41 |
| -!- heiko [~heiko@host86-185-9-87.range86-185.btcentralplus.com] has joined #shogun | 12:42 | |
| wiking | ok warnning fix: https://github.com/shogun-toolbox/shogun/pull/720 | 12:42 |
| CIA-21 | shogun: Viktor Gal master * r1f29074 / src/shogun/machine/LinearLatentMachine.cpp : Remove apply() implementation from LinearLatentMachine - http://git.io/vxi0jw | 12:42 |
| CIA-21 | shogun: Sergey Lisitsyn master * rbf3f2dd / src/shogun/machine/LinearLatentMachine.cpp : Merge pull request #720 from vigsterkr/latent - http://git.io/CBcQeg | 12:42 |
| CIA-21 | shogun: Sergey Lisitsyn master * rad15be9 / (5 files in 5 dirs): Fixed KRR examples - http://git.io/S-XKjA | 12:42 |
| blackburn | oops | 12:43 |
| blackburn | :D | 12:43 |
| -!- vojtech [9320543b@gateway/web/freenode/ip.147.32.84.59] has joined #shogun | 12:44 | |
| blackburn | uricamic: vojtech: is it possible to extend ocas or/and bmrm to use mixed norms like L1/Lq? | 12:45 |
| vojtech | blackburn: it would not be easy. | 12:46 |
| blackburn | in both cases? | 12:46 |
| vojtech | both translate the original hard problem to a simpler reduced problem which is QP task in the case of L2 norm | 12:47 |
| vojtech | if you would use L1 norm it would lead to LP | 12:47 |
| CIA-21 | shogun: Sergey Lisitsyn master * ree71cb3 / examples/undocumented/libshogun/test.cpp : Removed test example introduced by mistake - http://git.io/ZlpnDA | 12:47 |
| blackburn | I see | 12:47 |
| vojtech | it would not be stable | 12:48 |
| vojtech | it would require additional stabilization term | 12:48 |
| vojtech | not easy | 12:48 |
| wiking | heiko: yo | 12:48 |
| blackburn | I thought of two applications - multitask and group lasso-like thing | 12:48 |
| blackburn | that's why I asked | 12:48 |
| heiko | wiking hi | 12:48 |
| wiking | heiko: how's the mocking going? | 12:49 |
| blackburn | vojtech: what is use case of bmrm with proximal term? | 12:49 |
| heiko | wiking, the gmock installation is still not working, but I worked on something else the last days (cross-validation output stuff and labels) | 12:49 |
| heiko | Do you have a linux system where you can run the tests? | 12:49 |
| vojtech | blackburn, for example structured output SVM | 12:49 |
| wiking | heiko: cool, u mean you are having problem with the configure script? | 12:49 |
| wiking | heiko: yes indeed.. then i'll try to fix it for you | 12:49 |
| wiking | heiko: i've already installed gmock there from .deb | 12:50 |
| heiko | that would be great | 12:50 |
| heiko | which version? | 12:50 |
| wiking | so i see the problem with ./configure | 12:50 |
| blackburn | vojtech: I mean, what can we do with that w_t term in objective? | 12:50 |
| heiko | since the current one in debian/ubuntu doesnt have a config script | 12:50 |
| heiko | to get the paths | 12:50 |
| wiking | heiko: yeah neither this one... i mean i'm using latest LTS of ubuntu | 12:50 |
| heiko | I added the possibility to add a custom one to shogus confgure script | 12:50 |
| wiking | afaik htat's the latest ubuntu release ;P | 12:50 |
| heiko | but still I have problems | 12:50 |
| wiking | heiko: i see that | 12:50 |
| heiko | same here, latest ubuntu | 12:50 |
| wiking | heiko: i'll try to steal from somewhere the configure script for gmock ;P | 12:51 |
| wiking | heiko: i guess checkheader check lib will work as well | 12:51 |
| vojtech | blackburn, the proxy term is introduce to avoid zig-zag behaviour at early stages of convergence. I don't know what you can do with it ... | 12:51 |
| heiko | wiking, ok | 12:51 |
| vojtech | blackburn, may be I didn't understand the question | 12:51 |
| blackburn | vojtech: so it is just a helper thing? | 12:51 |
| vojtech | yes, to speedup convergence | 12:52 |
| blackburn | vojtech: well there are some domain adaptation formulations that pull w to some w_t | 12:52 |
| vojtech | I know | 12:52 |
| wiking | heiko: a bit scary stuff though.... is that for some reason the gmock package does not have gtest bundled into the package | 12:52 |
| wiking | heiko: so i'll have to add a gtest test as well | 12:53 |
| blackburn | vojtech: is that possible with that proximal term? | 12:53 |
| vojtech | blackburn, the implemented method is generic, i.e. you can add any convex term, e.g. additional proxy trerm | 12:53 |
| blackburn | vojtech: I see, thanks | 12:54 |
| heiko | wiking, ok , strange | 12:54 |
| heiko | wiking, I got loads of tests ready, so looking forward to this working :) | 12:54 |
| wiking | heiko: aaaah ok it does ... | 12:54 |
| wiking | heiko: it's just a dep package: Depends: libgtest-dev | 12:55 |
| heiko | I got that installed | 12:57 |
| blackburn | https://plus.google.com/u/0/104362980539466846301/posts/BJYQ2Z7Jht9 | 12:57 |
| gsomix_ | http://cs407527.userapi.com/v407527152/32ca/VEULdLVtHQI.jpg | 12:58 |
| -!- cheng [~cheng@115-64-111-17.tpgi.com.au] has joined #shogun | 12:59 | |
| -!- nicococo [~nico@lacedcoffee.ml.tu-berlin.de] has joined #shogun | 13:00 | |
| -!- alexlovesdata [~binder@e178008249.adsl.alicedsl.de] has joined #shogun | 13:02 | |
| @sonney2k | hmmhh what happened to the NY folks? | 13:04 |
| @sonney2k | blackburn, is chris away? | 13:05 |
| blackburn | sonney2k: I don't know | 13:05 |
| blackburn | who are NY folks? | 13:05 |
| @sonney2k | who else is missing - n4nd0 (who said that he cannot make it) | 13:05 |
| blackburn | I know only one | 13:06 |
| @sonney2k | blackburn, chris, puffin | 13:06 |
| blackburn | puffin is pretty far away from NY :) | 13:06 |
| @sonney2k | timezone wise - same | 13:06 |
| blackburn | you mean timezone wise | 13:06 |
| blackburn | yeah | 13:06 |
| @sonney2k | pluskid also cannot make it | 13:07 |
| @sonney2k | so I guess we can start then | 13:07 |
| @sonney2k | Alright everyone - welcome to our final celebration. | 13:07 |
| @sonney2k | Last weeks lots of PRs have been merged and I am very happy to see how much you have contributed (and hopefully will be contributing in the future). | 13:07 |
| @sonney2k | Now please everyone help getting shogun stable such that we can release version 2.0 with your code merged! So focus now is bugfixes (get the warnings down to ZERO), tests, documentation, tutorial. | 13:07 |
| @sonney2k | That said - only heiko sent me some figures for the new website. Excuses anyone? | 13:07 |
| heiko | >:o | 13:08 |
| @sonney2k | look heiko even shows his angry face | 13:08 |
| @sonney2k | uricamic, wiking, blackburn c'mon! | 13:09 |
| -!- pluskid [72f6b3c3@gateway/web/freenode/ip.114.246.179.195] has joined #shogun | 13:09 | |
| @sonney2k | pluskid, and you too :D | 13:09 |
| wiking | pluskid: you should hide! :) | 13:09 |
| blackburn | sonney2k: ich spreche englisch nicht | 13:09 |
| wiking | pluskid: sonney2k is angry :> | 13:09 |
| @sonney2k | welcome | 13:09 |
| @sonney2k | wiking, no heiko is | 13:09 |
| pluskid | wow, so few people? | 13:09 |
| * heiko raging | 13:09 | |
| cheng | pluskid: Hi, was worried that I had to actually do some work. ;-) | 13:10 |
| pluskid | cheng: haha :p | 13:10 |
| gsomix_ | >:3 | 13:10 |
| @sonney2k | so pluskid, uricamic, wiking, blackburn - please send pictures created with the aid of shogun *TODAY* | 13:10 |
| pluskid | sonney2k: sorry for absent during the last several days, but what kind of pictures do you need? | 13:11 |
| wiking | :> | 13:11 |
| @sonney2k | gsomix_ is somehow an exception - protocol buffers are not really hmmh screenshots | 13:11 |
| blackburn | das fasse ich nicht | 13:11 |
| heiko | pluskid, just something that shows how your methods work | 13:11 |
| @sonney2k | pluskid, some nice ones for the website | 13:11 |
| heiko | (which is easy for GP) | 13:11 |
| vojtech | sonney2k, could you remind us what kind of pictures. E.g. what picture should be send for a generic SVM solver ? | 13:11 |
| pluskid | sonney2k, heiko OK | 13:12 |
| heiko | you can do all these cool heatmap plot with posterior probabilities | 13:12 |
| cheng | pluskid: Once you get the sign dataset working, I guess there will be nice pictures. | 13:12 |
| pluskid | cheng: that is impossible for the *TODAY* deadline | 13:12 |
| @sonney2k | vojtech, well some illustrative application - something where you can show what a method does / how it does it in a figure | 13:12 |
| @sonney2k | something *fancy* | 13:12 |
| @sonney2k | I don't mind if you don't do it today but create a more fancy one a little later | 13:12 |
| @sonney2k | if you tell me when I get it | 13:13 |
| pluskid | sonney2k: are there any examples? | 13:13 |
| blackburn | cheng: pluskid: ah right sorry I forgot to prepare it | 13:13 |
| cheng | pluskid: I know. Didn't mean to pressure you. | 13:13 |
| pluskid | :) | 13:13 |
| @sonney2k | cheng, that is my job anyways ;) | 13:13 |
| shogun-buildbot_ | build #359 of deb3 - modular_interfaces is complete: Failure [failed test python_modular] Build details are at http://www.shogun-toolbox.org/buildbot/builders/deb3%20-%20modular_interfaces/builds/359 blamelist: Soeren Sonnenburg <sonne@debian.org> | 13:14 |
| @sonney2k | vojtech, e.g. for dimension reduction methods some embedding. for svm the usual figure good / vs bad with kernels (we have that already btw) | 13:14 |
| heiko | doorbell .. | 13:14 |
| blackburn | cowbell .. | 13:14 |
| @sonney2k | usually that is some small python script so you can aswell look for examples in examples/undocumented/<if>/graphical | 13:15 |
| @sonney2k | and add yours there | 13:15 |
| vojtech | sonney2k, ok we will create something | 13:15 |
| @sonney2k | and then just save the figure | 13:15 |
| @sonney2k | ok | 13:15 |
| @sonney2k | anyone still has questions to that? | 13:15 |
| @sonney2k | ... | 13:15 |
| @sonney2k | if not... | 13:15 |
| @sonney2k | lets continue | 13:16 |
| @sonney2k | Now for some formal stuff: According to the timeline https://www.google-melange.com/gsoc/events/google/gsoc2012 there are two upcoming todo items: | 13:16 |
| @sonney2k | 1. Mentors/Students - please submit your final evaluations by August 23rd latest (24th is the hard deadline from google). | 13:16 |
| @sonney2k | 2. Students submit your code samples to google (blackburn will send around a script on the mailinglist to do this) after August 31. | 13:16 |
| @sonney2k | so 1) is very important not to miss for mentors/students | 13:16 |
| @sonney2k | otherwise no money for the student | 13:16 |
| heiko | one more thing about the plots: please use the latex integration script in the graphical folder in python_modular, it ensures that all plots integrate well with the tutorial | 13:17 |
| @sonney2k | so students push you mentors! | 13:17 |
| @sonney2k | it will be the same effort as last time btw | 13:17 |
| @sonney2k | heiko, well I just need .png's or /jpgs for now - I think we can do the rest for the tutorial later | 13:18 |
| gsomix_ | sonney2k, *push* | 13:18 |
| heiko | sonney2k, I know, still, its just one line import | 13:18 |
| @sonney2k | gsomix_, no worries | 13:18 |
| heiko | Then they all have same fonts etc | 13:18 |
| @sonney2k | that reminds me, heiko, pluskid, blackburn have been writing some nice tutorial / documentation for their parts | 13:18 |
| @sonney2k | you can find the latex source under shogun/doc/tutorial | 13:19 |
| cheng | like +1 | 13:19 |
| @sonney2k | please in the final weeks contribute to that tutorial | 13:19 |
| pluskid | its in submodular btw | 13:19 |
| pluskid | module? | 13:19 |
| @sonney2k | vojtech, uricamic - you could probably just copy formulas description over from your .tex source of your papers | 13:20 |
| uricamic | ok | 13:20 |
| @sonney2k | nicococo, and you too | 13:20 |
| nicococo | si claro | 13:20 |
| gsomix_ | btw, if somebody wants to check shogun on python3 - welcome. :) | 13:20 |
| @sonney2k | gsomix_, I did only once but weeks ago - it worked nicely - maybe we need a buildbot test... | 13:21 |
| @sonney2k | students: regarding 2) this is an easy task with the script blackburn will send around - so don't worry too much about it | 13:21 |
| blackburn | 67 warnings left | 13:21 |
| @sonney2k | please help us getting these 67 -> 0 | 13:22 |
| uricamic | I have few warnings still there, I am waiting for the wiking PR to merge and I will fix them | 13:22 |
| blackburn | uricamic: are you ok to merge it? | 13:22 |
| @sonney2k | as a reminder: that's the url where you can see the status http://shogun-toolbox.org/buildbot/waterfall | 13:22 |
| uricamic | blackburn: yes | 13:22 |
| blackburn | okay that's what I was waiting for | 13:23 |
| CIA-21 | shogun: Viktor Gal master * ra72e3cf / (25 files in 4 dirs): | 13:23 |
| CIA-21 | shogun: Refactor RiskFunction in structure methods This code refactoring basically adds | 13:23 |
| CIA-21 | shogun: RiskFunction functionality into StructuredModel. This way we can remove | 13:23 |
| CIA-21 | shogun: RiskFunction and all the related objects and have only one user defined class | 13:23 |
| CIA-21 | shogun: (StructuredModel) for SO methods. - http://git.io/9bPKaA | 13:23 |
| CIA-21 | shogun: Sergey Lisitsyn master * r3ce4fd2 / (25 files in 4 dirs): Merge pull request #719 from vigsterkr/so - http://git.io/KheEig | 13:23 |
| uricamic | I see, I didn't know that :) | 13:23 |
| uricamic | ok, thx | 13:23 |
| blackburn | yeah I kept it in secret | 13:23 |
| blackburn | :D | 13:23 |
| blackburn | (forgot to ask) | 13:23 |
| uricamic | :D | 13:23 |
| @sonney2k | so | 13:23 |
| @sonney2k | Now please everyone tell us what you liked about doing shogun - GSoC, what you did hate. Any kind of honest criticism / feedback is very welcome such that we can learn what we should improve. I very much prefer unfiltered direct feedback (like fuck of Soeren!!!) in contrast to not letting us know you did hate us :D | 13:23 |
| wiking | wooohoooo BIGPATCH :) | 13:23 |
| @sonney2k | who wants to start? | 13:23 |
| @sonney2k | pluskid/cheng? | 13:23 |
| cheng | pluskid? | 13:24 |
| pluskid | sonney2k: so this time complain instead of weekly summary? | 13:24 |
| @sonney2k | pluskid, is this a complaint? | 13:24 |
| @sonney2k | :) | 13:24 |
| pluskid | :D | 13:24 |
| @sonney2k | please complain :D | 13:25 |
| pluskid | I would say great org! | 13:25 |
| pluskid | but shall I complain about SG_REF/SG_UNREF? | 13:25 |
| @sonney2k | (I don't mind others joining pluskids complaints) | 13:25 |
| blackburn | sonney2k: tarball generator is in the mailing list | 13:25 |
| pluskid | I always forget about when should a SG_REF be put :p | 13:25 |
| @sonney2k | pluskid, sure complain about what you hate | 13:25 |
| @sonney2k | pluskid, that is why we need you post-gsoc | 13:26 |
| @sonney2k | otherwise this mechanism will stay until the nd of days | 13:26 |
| @sonney2k | *end | 13:26 |
| pluskid | oh, I'm starting to regret for saying that :>>> | 13:26 |
| cheng | pluskid: Is there stuff from an organisation viewpoint of GSoC that we could make better? | 13:26 |
| blackburn | pluskid: we know you are going to do some research so please take a little effort if required to use shogun | 13:26 |
| blackburn | it is worth the thing I am sure | 13:27 |
| @sonney2k | at least it paid off here | 13:27 |
| pluskid | I guess sending some small gifts to the students will be nice, like bages or T-shirts with SHOGUN on it | 13:27 |
| pluskid | blackburn, sonney2k: sure~~ | 13:27 |
| blackburn | shogun get me paid with a lot of useful contacts and skills one can miss when developing they own solution | 13:27 |
| @sonney2k | pluskid, we need some shogun design for the t-shirt ... | 13:28 |
| pluskid | btw, I saw someone comparing their algorithm with the MKL in shogun at KDD | 13:28 |
| @sonney2k | pluskid, yeah shogun is known for MKL :( | 13:28 |
| @sonney2k | or :) | 13:28 |
| pluskid | sonney2k: why :( ? :D | 13:28 |
| blackburn | I'd like to have a t-shirt with https://dl.dropbox.com/u/10139213/shogun/sonne.jpg | 13:29 |
| @sonney2k | pluskid, any other feedback? | 13:29 |
| pluskid | btw, I'm finished with my complain | 13:29 |
| @sonney2k | vojtech, uricamic - mind to continue? | 13:29 |
| @sonney2k | blackburn, then print it yourself | 13:29 |
| blackburn | sonney2k: no I believe it should be official | 13:29 |
| @sonney2k | blackburn, but I usually don't wear pants o_O | 13:30 |
| blackburn | sonney2k: only t-shirt? | 13:30 |
| gsomix_ | blackburn, \m/ | 13:30 |
| blackburn | bad boy | 13:30 |
| vojtech | sonney2k, Michal should say what he likes/dislikes as he did the work. I was just a scientific support :) | 13:30 |
| @sonney2k | vojtech, well you can complain too :D | 13:31 |
| @sonney2k | wiking / alexlovesdata you too please start to complain | 13:31 |
| uricamic | well, I quite enjoyed GSoC, so I don't have much complains | 13:31 |
| blackburn | sonney2k: https://dl.dropbox.com/u/10139213/shogun/pics.png is that a nice pic? :D | 13:32 |
| uricamic | maybe just our little misunderstanding that resulted in little divergence in so framework :) | 13:32 |
| @sonney2k | uricamic, I hope that this is resolved by now :) | 13:32 |
| vojtech | sonney2k, This year everything went quite smoothly. w.r.t organization I new it from the previous year and w.r.t coding Michal works independently = minimal load for me :) | 13:32 |
| uricamic | there is only one thing left I need to discuss with n4ndo | 13:33 |
| blackburn | vojtech: sonney2k removed your last gsoc project in the middle of summer :D | 13:33 |
| @sonney2k | we never had such strong interdependence like in wikings/n4nd0s/uricamics task | 13:33 |
| blackburn | thanks to me :D I restored it with stl vector instead | 13:33 |
| @sonney2k | but it is back now | 13:33 |
| uricamic | he made some change in the last PR that results in shogun exception when BMRM used for trainig | 13:33 |
| wiking | all's great but why cannot we use STD! :D | 13:34 |
| uricamic | but I guess, it will be easy to fix that too | 13:34 |
| wiking | especially STL :D | 13:34 |
| vojtech | blackburn: which project ? The EM algorithm from the last year ? | 13:34 |
| blackburn | vojtech: yeah | 13:34 |
| @sonney2k | wiking, you sound a bit like pluskid - anyway some exceptions are OK but only in .cpp files (though I still don't like it) | 13:35 |
| vojtech | very good, I know people who use it in their work ... | 13:35 |
| wiking | sonney2k: nah it was just a joke... i mean we can live w/o it | 13:35 |
| @sonney2k | nicococo, heiko, blackburn anything you want to complain about? | 13:35 |
| wiking | got used to SGVector and SGMatrix | 13:35 |
| nicococo | n4nd0 is not here i can't complain for him. for me it was pure joy ;) | 13:35 |
| blackburn | sonney2k: I am so integrated to shogun - I can complain only about myself I guess | 13:36 |
| blackburn | :D | 13:36 |
| heiko | not here, I wanted the unit-tests, which we now have. Apart from that, everything fine! :) pretty much enjoyed it | 13:36 |
| @sonney2k | blackburn, shall I complain about you then? | 13:36 |
| blackburn | sonney2k: yeah feel free :D | 13:36 |
| @sonney2k | blackburn, you always break the build :D | 13:36 |
| @sonney2k | is that a hobby? | 13:36 |
| blackburn | no I don't, I always repair the build | 13:37 |
| wiking | heiko: dont lie you dont have it! :D | 13:37 |
| wiking | heiko: but will soon ;P | 13:37 |
| heiko | wiking, I HOPE SO!!!! :D | 13:37 |
| wiking | ah yeah | 13:37 |
| wiking | as a complaint maybe | 13:37 |
| wiking | a serious one | 13:37 |
| wiking | why we no switch to cmake completely? | 13:37 |
| @sonney2k | OK so does anyone have an opinion in which direction shogun should be developed in the future? | 13:38 |
| uricamic | wiking: yep I would appreciate that too :) | 13:38 |
| wiking | cmake it :) | 13:38 |
| uricamic | +1 :) | 13:38 |
| @sonney2k | wiking, that sounds like a longer discussion we should rather do offline | 13:38 |
| wiking | hehe ok i'm just saying that now with all the ./configure script hacks i had lately | 13:38 |
| wiking | i know that half of them are not portable | 13:39 |
| cheng | How about making sure that shogun goes into the standard distributions? | 13:39 |
| wiking | i.e. woulnd't work on some arch/distrib combination | 13:39 |
| @sonney2k | wiking, huge effort in any case | 13:39 |
| wiking | but yeah i know that it does take some time | 13:39 |
| wiking | btw: another good thing would be if some GUI guy would come around | 13:39 |
| cheng | I mean updating the other repositories with more recent versions. | 13:39 |
| wiking | and make a nice gui for shogun :) | 13:40 |
| blackburn | gui? why? | 13:40 |
| heiko | wiking, gui? | 13:40 |
| @sonney2k | cheng, yeah I tried to do shogun packages for debian/ ubuntu but badly maintained them (due to other errors in clang on powerpc / python packaging stuff)... | 13:40 |
| wiking | yep | 13:40 |
| heiko | pretty much work, huge | 13:40 |
| @sonney2k | what? | 13:40 |
| @sonney2k | gui? | 13:40 |
| heiko | and also, why | 13:40 |
| blackburn | no idea how gui looks like :D | 13:40 |
| @sonney2k | Isn't python the guy gui? | 13:40 |
| wiking | why not? :) i mean i know so many people who wouldn't touch anything that's command line (and they all hack weka because of that) | 13:40 |
| shogun-buildbot_ | build #360 of deb3 - modular_interfaces is complete: Failure [failed test python_modular] Build details are at http://www.shogun-toolbox.org/buildbot/builders/deb3%20-%20modular_interfaces/builds/360 blamelist: Viktor Gal <viktor.gal@maeth.com> | 13:40 |
| wiking | yeeey i broke it! | 13:41 |
| blackburn | no | 13:41 |
| @sonney2k | it was all broken anywyas | 13:41 |
| blackburn | it was | 13:41 |
| wiking | ah ok it wasn't me | 13:41 |
| wiking | :) | 13:41 |
| cheng | How about instead of a gui, a html interface? | 13:41 |
| @sonney2k | but no one fixed it... | 13:41 |
| wiking | cheng: that's gui as well :) | 13:41 |
| blackburn | I know the cause | 13:41 |
| wiking | cheng: i mean yeah a nice html fronted would be great as well | 13:41 |
| gsomix_ | only command line, only hardcore :) | 13:41 |
| cheng | sonney2k: for many people, installing from source sounds too scary. | 13:42 |
| heiko | sonney2k, yes, I double that | 13:42 |
| blackburn | from my experience shogun is not enough and you do a cross-library thing | 13:42 |
| blackburn | no idea how to gui that | 13:42 |
| heiko | I know quite a feq scientists who never compiled anything, so it would be great to have at least debian/ubuntu biulds for shogun | 13:42 |
| blackburn | yeah auto .deb | 13:43 |
| @sonney2k | django / shogun ... possible but danger is that we get lots of newbie users | 13:43 |
| @sonney2k | heiko, blackburn, cheng pre-built stuff is on the todo then | 13:43 |
| @sonney2k | anyone has some new ML domains / algorithms in mind? | 13:44 |
| blackburn | sonney2k: ahh we need to emphasize that static is not recommended unless you know what you do | 13:44 |
| cheng | wiking: I suggest html instead of gui because building cross platform windows is tough. | 13:44 |
| blackburn | cheng: we do not support windows natively anyway | 13:44 |
| cheng | sonney2k: deep networks | 13:44 |
| wiking | cheng: second that | 13:45 |
| @sonney2k | cheng, find us some mentor ... | 13:45 |
| blackburn | lecun | 13:45 |
| @sonney2k | cheng, ask Yann at NIPS :D | 13:45 |
| blackburn | :D | 13:45 |
| cheng | blackburn: I mean like OSX (sorry, overloaded the word windows( | 13:45 |
| cheng | blackburn: Qt and Tk are tricky on osx. | 13:45 |
| blackburn | yeah | 13:45 |
| blackburn | and I do not want to develop gui | 13:45 |
| blackburn | :D | 13:45 |
| -!- gsomix_ is now known as gsomix | 13:46 | |
| blackburn | cheng: sonney2k: I agree we have to have deep learning here | 13:46 |
| @sonney2k | but seriously, cheng, nicococo, vojtech ask at ML conferences if you find sth interesting if these authors wouldn't mind to mentor next year | 13:46 |
| blackburn | however it is a kind of magic | 13:46 |
| @sonney2k | none of us here has any clue about deep learning | 13:46 |
| @sonney2k | (except from literature) | 13:46 |
| wiking | :) | 13:46 |
| wiking | use Theano | 13:46 |
| nicococo | i can ask gregoire montavon (sitting next to me) he is well known for his deep networks... | 13:46 |
| cheng | sonney2k: I will do some salesman stuff. | 13:46 |
| wiking | pretty heavy weight shit :) | 13:46 |
| @sonney2k | so we need an expert | 13:47 |
| @sonney2k | otherwise better not touch this field | 13:47 |
| blackburn | we wanted to implement LMNN | 13:47 |
| blackburn | no idea if it is hot still | 13:47 |
| @sonney2k | cheng, well there is yann's lush, torch5 or 7 , theano ... | 13:47 |
| @sonney2k | I would rather steal code than doing everything from scratch though | 13:48 |
| cheng | The other popular area is sparse learning, compressed sensing. | 13:48 |
| @sonney2k | *borrow! | 13:48 |
| blackburn | yeah compressed sensing is really hot | 13:48 |
| cheng | I just saw David Donoho being a superhero at an MRI conference. | 13:48 |
| blackburn | i should contact igor carron and ask about mentoring something | 13:48 |
| @sonney2k | ok if you still have ideas bring them on any time but lets continue for now | 13:49 |
| @sonney2k | Students/Mentors as usual please give us an update - what is left to do / or do you still intend to do before the planned shogun release (September 1) and maybe later. Did you manage to implement everything you put on your schedule / are you satisfied with the work you did or what do you want to improve? | 13:49 |
| cheng | Quite amazing for a mathematician to be an invited speaker at an application conference. | 13:49 |
| @sonney2k | pluskid, you wanted to start with that I remember :D | 13:49 |
| pluskid | ok | 13:49 |
| pluskid | before the end of GSoC | 13:50 |
| pluskid | I was mainly cleanning up the code, and writing the tutor | 13:50 |
| pluskid | I wish to complete the multiclass part of the tutor | 13:50 |
| @sonney2k | pluskid, I know you want to do SG_REF/UNREF in the future (you all are witnesses) | 13:50 |
| pluskid | sonney2k: hope I have time for that | 13:50 |
| pluskid | :D | 13:50 |
| @sonney2k | vojtech, cheng, btw can you contribute some latex for the tutorial? you also have written quite a bit of papers that could fill a few sections... | 13:51 |
| cheng | sonney2k: Sure | 13:51 |
| @sonney2k | pluskid, us too. | 13:51 |
| @sonney2k | gsomix, mind to continue? | 13:51 |
| blackburn | pluskid: cheng: let us discuss road sign data just after meeting? | 13:52 |
| vojtech | sonney2k, yes we can write it | 13:52 |
| pluskid | blackburn: ok! | 13:52 |
| cheng | blackburn: great | 13:52 |
| gsomix | sonney2k, mmm? | 13:52 |
| gsomix | I lost the thread of the discussion :( | 13:53 |
| wiking | gsomix: complain :))) | 13:53 |
| blackburn | gsomix: what is left to do? | 13:53 |
| blackburn | what do you want to do and what you are happy and unhappy with? | 13:54 |
| gsomix | ah | 13:54 |
| @sonney2k | gsomix, you can also say what you did if you want :) | 13:54 |
| @sonney2k | wiking, alexlovesdata - maybe you next then? | 13:55 |
| gsomix | I just want to finish protocols/directors/typemaps for needed classes. And I'm happy with it. | 13:55 |
| alexlovesdata | wiking? | 13:55 |
| @sonney2k | gsomix, to the point as usual :) | 13:55 |
| wiking | sonney2k: i have complained already :D | 13:56 |
| wiking | sonney2k: and gave suggestion about what woudl be gread in long run for shogun | 13:56 |
| @sonney2k | wiking, yes but what is left todo? | 13:56 |
| wiking | sonney2k: ah ok | 13:56 |
| @sonney2k | what will you do before release? | 13:56 |
| wiking | sonney2k: left to do: give you nice pictures, add a part into tutorial and now after the last 2 PRs of yesterday merge latentmodel with structuredmodel resulting in latent so svm | 13:57 |
| wiking | they'll be done in reverse order :) | 13:57 |
| @sonney2k | some nice examples that create figures would be optimal | 13:58 |
| wiking | yeps | 13:58 |
| @sonney2k | vojtech, uricamic - please continue | 13:58 |
| wiking | maybe i push then tutorial the last task | 13:58 |
| alexlovesdata | ye,we had also an idea like that | 13:58 |
| alexlovesdata | to create an example that yields some pics of detection finds | 13:58 |
| uricamic | ok, todo: produce examples that creates some pictures | 13:59 |
| uricamic | + contribute to the turorial | 13:59 |
| @sonney2k | uricamic, code is ready otherwise right? | 13:59 |
| @sonney2k | uricamic, btw didn't you want to do some benchmark / comparison? | 13:59 |
| uricamic | the learning algorithms are ok | 13:59 |
| @sonney2k | ok | 14:00 |
| blackburn | uricamic: we need to fix multiclass | 14:00 |
| blackburn | it is not being initialized when using risk | 14:00 |
| wiking | blackburn: ? | 14:00 |
| blackburn | wiking: python example fails | 14:00 |
| wiking | aah | 14:00 |
| wiking | ok that might be my bad as well | 14:00 |
| blackburn | no | 14:00 |
| blackburn | it was there before | 14:00 |
| uricamic | yep, I guess the problem is in the last PR from n4ndo, now when someone uses BMRM for training it then results in exception | 14:00 |
| wiking | ah ok | 14:00 |
| @sonney2k | uricamic, ^ | 14:01 |
| blackburn | uricamic: in argmax number of classes is set | 14:01 |
| blackburn | you don't call argmax so number of classes is not set | 14:01 |
| vojtech | sonney2k, we plan to submit a paper about the method. This will require doing benchmarks. | 14:01 |
| blackburn | that's the only reason | 14:01 |
| uricamic | yep, but the current multiclass risk function does not use argmax at all | 14:01 |
| uricamic | yep | 14:01 |
| blackburn | uricamic: that needs to be handled somehow | 14:01 |
| @sonney2k | vojtech, would be nice to have this figure / comparison in the tutorial I think | 14:02 |
| uricamic | I know, I wanted to discuss this with n4ndo, but haven't catch him yet | 14:02 |
| vojtech | sonney2k, we have some comparison - figures - already. We will put it to the tutorial | 14:02 |
| uricamic | also there have been some problem with MulticlassSOLabels that valgrind complained about | 14:02 |
| @sonney2k | heiko, maybe you continue? | 14:02 |
| @sonney2k | vojtech, ok | 14:03 |
| heiko | yeah, ok | 14:03 |
| heiko | I finished everything, that is all two-sample and independence tests | 14:03 |
| @sonney2k | uricamic, just fix this then or talk to us after the meeting :) | 14:03 |
| heiko | recently did minor updates and optimisations | 14:03 |
| uricamic | sonney2k: sure | 14:03 |
| heiko | examples | 14:03 |
| * sonney2k worldmodel complete | 14:03 | |
| heiko | tutorial | 14:03 |
| heiko | so my project is ready from what was is the proposal | 14:03 |
| heiko | there are lots of things that I still like to integrate, but that will happen after shogun2.0 | 14:04 |
| @sonney2k | heiko, so what would you want to do before (if you have time...) | 14:04 |
| heiko | this week, I want to get grips with the unit tests | 14:04 |
| heiko | I wrote a lot of them, they are currently in the examples | 14:04 |
| heiko | also, currently I am working on a more sophisticated cross-validation intermediate result thing | 14:05 |
| heiko | based on blackburns ModelSelectionOutput | 14:05 |
| -!- yoo [2eda6d52@gateway/web/freenode/ip.46.218.109.82] has joined #shogun | 14:05 | |
| heiko | (they guy from cambridge wanted this and I remember other poeple asking | 14:05 |
| yoo | hi all | 14:05 |
| @sonney2k | ok | 14:05 |
| heiko | I also integrated this john plat sigmoid fitting for the labels, that has to be integrated. and there is an extension for multiclass that I wrote and want to add to shogun | 14:05 |
| heiko | apart from the bugfixing7warnings etc | 14:06 |
| heiko | one thing: | 14:06 |
| @sonney2k | that is a lot already | 14:06 |
| @sonney2k | (if you intend to sleep) | 14:06 |
| shogun-buildbot_ | build #361 of deb3 - modular_interfaces is complete: Failure [failed test python_modular] Build details are at http://www.shogun-toolbox.org/buildbot/builders/deb3%20-%20modular_interfaces/builds/361 blamelist: Sergey Lisitsyn <lisitsyn.s.o@gmail.com> | 14:06 |
| heiko | from next week, I will have to take a step back since my Master's thesis deadline is on 7th Sept | 14:06 |
| heiko | so a few hours less per week for shogun | 14:06 |
| @sonney2k | I was wondering already... | 14:06 |
| heiko | Its already in a pretty good state | 14:07 |
| heiko | but writing things up takes time | 14:07 |
| @sonney2k | better focus on your thesis then | 14:07 |
| @sonney2k | we don't want you to fail with that! | 14:07 |
| heiko | and yes, sleeping is important for me :D | 14:07 |
| blackburn | I am wondering what should I do in my master thesis :D | 14:07 |
| blackburn | I am totally lost in ML now | 14:07 |
| cheng | blackburn: in computer science? | 14:07 |
| heiko | blackburn, you can jsut ask people to host you | 14:07 |
| blackburn | cheng: yeah I want to do ML but don't know what to do at all | 14:07 |
| blackburn | host me? | 14:08 |
| heiko | yes your thesis | 14:08 |
| heiko | You can ask other people that at you uni | 14:08 |
| blackburn | I am unsure I understand what do you mean | 14:08 |
| blackburn | ahh | 14:08 |
| @sonney2k | I guess blackburn you should take over | 14:08 |
| blackburn | I am the biggest expert in ML here | 14:08 |
| blackburn | :D | 14:08 |
| shogun-buildbot_ | build #288 of deb2 - static_interfaces is complete: Failure [failed test cmdline_static] Build details are at http://www.shogun-toolbox.org/buildbot/builders/deb2%20-%20static_interfaces/builds/288 blamelist: Sergey Lisitsyn <lisitsyn.s.o@gmail.com>, Viktor Gal <viktor.gal@maeth.com> | 14:08 |
| gsomix | sad, but true :( | 14:08 |
| @sonney2k | right after vladimir V. | 14:09 |
| heiko | He's in London :) | 14:09 |
| cheng | Hey, if you contribute to shogun, you are by definition an ML expert. | 14:09 |
| blackburn | in my university rare professor know what SVM is | 14:09 |
| blackburn | may be 3-4 of they do know | 14:09 |
| heiko | blackburn, thats why I suggested to ask other people :) | 14:09 |
| blackburn | heiko: other people where/ | 14:09 |
| heiko | e.g. London/Berlin | 14:10 |
| blackburn | ahh | 14:10 |
| blackburn | well that's something optional for they | 14:10 |
| heiko | Then you got one supervisor locally and the other one somewhere else | 14:10 |
| heiko | anyway, lets talk about that later :) | 14:10 |
| blackburn | yeah ok | 14:10 |
| @sonney2k | blackburn, if you want to go to berlin, or anywhere it would probably not be a problem | 14:10 |
| @sonney2k | just choose the city / group... | 14:11 |
| @sonney2k | task etc | 14:11 |
| blackburn | sonney2k: I am not able to leave country yet | 14:11 |
| @sonney2k | blackburn, but please continue with what you have done | 14:11 |
| @sonney2k | err | 14:11 |
| @sonney2k | want to do :D | 14:11 |
| blackburn | I will just be arrested and happily go to army lol | 14:11 |
| cheng | ML for military. Very bad. | 14:12 |
| blackburn | cheng: that's mandatory here but not when I am studying here | 14:12 |
| @sonney2k | seems like blackburn is shy today | 14:12 |
| blackburn | sonney2k: shy? | 14:12 |
| blackburn | why shy? | 14:12 |
| blackburn | probably I interrupted the process :D | 14:13 |
| @sonney2k | blackburn, anything you want to do before shogun 2.0 / sth still on todo? | 14:13 |
| @sonney2k | what you want to improve in your (other) code? | 14:13 |
| blackburn | yes, I am going to extend liblinear with MTL graph setting for regression problems | 14:13 |
| blackburn | then I wanted to unify its API | 14:13 |
| blackburn | and extend existing SLEP solver with overlapping group lasso | 14:14 |
| @sonney2k | vojtech, before I forget - labels in multiclass ocas are 0...<nr_classes-1> ? | 14:14 |
| blackburn | may be some examples to do too | 14:14 |
| @sonney2k | blackburn, pictures :D | 14:14 |
| blackburn | I got no idea about pictures | 14:15 |
| cheng | crazy idea: would shogun work on a phone or tablet? | 14:15 |
| @sonney2k | blackburn, well discuss with chris - you can probably show how a decision surface is changed when multi/dual task stuff is used | 14:16 |
| blackburn | cheng: probably that's possible, but what to do with it? | 14:16 |
| @sonney2k | cheng, sure it runs on gunnars iphone for years | 14:16 |
| cheng | you can go around classifying stuff with the phone camera. | 14:16 |
| @sonney2k | (we even tweaked configure for that) | 14:16 |
| blackburn | oh well it is rather opencv example | 14:16 |
| alexlovesdata | @cheng: cloudi nterface for shogun :P | 14:16 |
| -!- emrecelikten [~emre@trir-5d8007aa.pool.mediaWays.net] has joined #shogun | 14:16 | |
| blackburn | but actually I know how to implement that | 14:16 |
| vojtech | sonney2k, labels in libocas: 1,2,3...nY | 14:16 |
| wiking | cheng: it works with raspebrry pi | 14:17 |
| wiking | cheng: *raspberry | 14:17 |
| wiking | cheng: alas it should be possible to use it on iphone | 14:17 |
| @sonney2k | wiking, hmmh then I guess we need to label[i]+1 ... | 14:17 |
| wiking | sonney2k: but that way i get really all the labels shifted :) | 14:17 |
| @sonney2k | ok then does anyone have any final comments / questions? | 14:17 |
| cheng | I think it has been a great GSoC. | 14:18 |
| wiking | sonney2k: the labels are shifted by +1 | 14:18 |
| cheng | Very lively group of students this year. | 14:18 |
| @sonney2k | heh | 14:18 |
| pluskid | how time flies | 14:18 |
| @sonney2k | Finally, once GSoC is over real live will usually require much more time - so IRC might be less helpful than postings on the mailinglist. I think it would be nice if we authors would post using some official me@shogun-toolbox.org email address. So everyone here who intends to stick around should get this forward. | 14:19 |
| @sonney2k | So final words - thanks all for your great efforts. It has been fun (at least for me and I hope for you too). We hope you will stick around - please keep in touch in one way or another... | 14:20 |
| blackburn | for ones who are interested in some careers it is useful for sure | 14:20 |
| blackburn | I got contacted by google twice because of shogun :D | 14:20 |
| cheng | Also, spread the word about shogun to your colleagues. We want more users and also more potential developers. | 14:21 |
| * pluskid is hesitating to update his resume | 14:21 | |
| pluskid | *hurrying | 14:21 |
| wiking | blackburn: :> | 14:21 |
| @sonney2k | please stay subscribed to the mailinglist - you will notice that at some point people start to use your code :D | 14:22 |
| @sonney2k | but usually only when they get stock | 14:22 |
| @sonney2k | *stuck | 14:22 |
| @sonney2k | anyways, meeting is over from my side! | 14:22 |
| @sonney2k | you can stay here and keep on partying | 14:22 |
| heiko | nice one :) | 14:22 |
| alexlovesdata | thanks for the great organization effort Soeren! | 14:23 |
| @sonney2k | blackburn has some vodka for all of you ready | 14:23 |
| @sonney2k | virtual only though | 14:23 |
| @sonney2k | but hopefully next year we can organise some shogun mini conf | 14:23 |
| @sonney2k | (in berlin...) | 14:23 |
| emrecelikten | Apparently I came in just in time | 14:23 |
| blackburn | :D | 14:23 |
| @sonney2k | heiko, that reminds me - any news on the verein issue - otherwise we loose 50% of the money... | 14:23 |
| gsomix | sonney2k, thanks | 14:24 |
| @sonney2k | that would just mean less travel support... | 14:24 |
| heiko | sonney2k, argh, sorry, I will check that out now | 14:24 |
| @sonney2k | (next year) | 14:24 |
| gsomix | may the Forc^W Carol Smith be with you | 14:24 |
| heiko | sonney2k, I think a meeting would be very cool! | 14:24 |
| wiking | heiko: i think i've got it :) | 14:24 |
| @sonney2k | pluskid, find out if you have vacations at MIT or if there is a conference in germany you need to attend! | 14:25 |
| heiko | wiking, great, send something | 14:25 |
| wiking | heiko: i'll just double-check if it works smoothly on the ubuntu | 14:25 |
| heiko | ok | 14:25 |
| wiking | heiko: as now i've tested on my machine... it works w/o the gmock-config script | 14:25 |
| pluskid | sonney2k: :D I know I can get free lunch from you | 14:25 |
| alexlovesdata | hey blackburn: a world fusion approach for your thesis : http://www.cs.cmu.edu/~epxing/papers/2011/Zhu_Chen_Xing_NIPS11.pdf | 14:25 |
| blackburn | pluskid: cheng: mind to join some channel to discuss? it could be some flood like to discuss here | 14:26 |
| @sonney2k | alright - I have to get kids from kindergarden but just ignore me - keep on partying | 14:26 |
| pluskid | blackburn: cool, how to set up a channel? | 14:26 |
| gsomix | time to work | 14:26 |
| blackburn | just join #shogun2 | 14:26 |
| blackburn | :D | 14:26 |
| blackburn | alexlovesdata: what to do with it? | 14:26 |
| blackburn | :D | 14:26 |
| alexlovesdata | read it :) | 14:27 |
| alexlovesdata | it is sufficiently unusual to be YOUR thesis | 14:27 |
| alexlovesdata | in the discriminative part you can do everything | 14:27 |
| blackburn | alexlovesdata: you mean just copy that and treat it as my thesis? :D | 14:27 |
| heiko | I also gotta go, wiking, I will check back on the testing later this evening | 14:28 |
| blackburn | sounds like russian science | 14:28 |
| alexlovesdata | aehmmm, we are NOT in social sciences, blackburn! | 14:28 |
| -!- heiko [~heiko@host86-185-9-87.range86-185.btcentralplus.com] has left #shogun [] | 14:29 | |
| blackburn | alexlovesdata: I am unsure what does it mean | 14:30 |
| alexlovesdata | in principle they interpret bayes rule as an optimization problem | 14:33 |
| alexlovesdata | then they can add an additional penalty on the space of probabilistic models | 14:33 |
| alexlovesdata | they are doing something like probabilistic mixture of local svms | 14:33 |
| alexlovesdata | their idea is fun | 14:34 |
| alexlovesdata | a mixture of both worlds ;) | 14:34 |
| wiking | wtf :))))) | 14:34 |
| alexlovesdata | I need to read it in detail ,too | 14:34 |
| wiking | why no libgtest.so ?! | 14:34 |
| wiking | on ubuntu | 14:34 |
| blackburn | hmm | 14:34 |
| alexlovesdata | would that be the next GSoC 2013 project? :D | 14:34 |
| blackburn | alexlovesdata: okay I will check that | 14:34 |
| wiking | there's libgtest-dev with header files but no actual libgtest | 14:35 |
| alexlovesdata | blackburn: are you satill pursuing ILSRVC | 14:35 |
| blackburn | alexlovesdata: wiking does | 14:35 |
| blackburn | alexlovesdata: I am waiting for thing I can help with | 14:35 |
| wiking | but now i'm truing this shitfuck:))) | 14:35 |
| wiking | why no gtest library on ubuntu | 14:35 |
| blackburn | alexlovesdata: I have ~0 clue about that kind of recognition :) | 14:36 |
| wiking | doh | 14:39 |
| wiking | something is wrong with ubuntu :) | 14:39 |
| -!- alexlovesdata [~binder@e178008249.adsl.alicedsl.de] has left #shogun [] | 14:40 | |
| -!- nicococo [~nico@lacedcoffee.ml.tu-berlin.de] has left #shogun [] | 14:40 | |
| wiking | ahhaha fuckers | 14:41 |
| wiking | somebody fucked up ubuntu release | 14:41 |
| wiking | they left out libgtest0 | 14:41 |
| wiking | :DDD | 14:41 |
| wiking | natty is the last release that still has it | 14:41 |
| wiking | after that they only have libgtest-dev | 14:41 |
| wiking | that only contains the headers :D | 14:41 |
| wiking | wtf :D | 14:41 |
| wiking | http://packages.ubuntu.com/search?keywords=libgtest0 | 14:42 |
| wiking | :> | 14:42 |
| -!- blackburn [~blackburn@62.106.106.114] has quit [Quit: Leaving.] | 14:49 | |
| wiking | blackburn noooo | 14:49 |
| wiking | who's gonna merge noooow! :) | 14:49 |
| -!- cheng [~cheng@115-64-111-17.tpgi.com.au] has quit [Quit: Leaving.] | 14:51 | |
| -!- pluskid [72f6b3c3@gateway/web/freenode/ip.114.246.179.195] has quit [] | 14:52 | |
| -!- pluskid [72f6b3c3@gateway/web/freenode/ip.114.246.179.195] has joined #shogun | 14:53 | |
| gsomix | sonney2k, around? | 15:03 |
| shogun-buildbot_ | build #362 of deb3 - modular_interfaces is complete: Failure [failed test python_modular] Build details are at http://www.shogun-toolbox.org/buildbot/builders/deb3%20-%20modular_interfaces/builds/362 blamelist: Sergey Lisitsyn <lisitsyn.s.o@gmail.com>, Viktor Gal <viktor.gal@maeth.com> | 15:04 |
| shogun-buildbot_ | build #289 of deb2 - static_interfaces is complete: Failure [failed test cmdline_static] Build details are at http://www.shogun-toolbox.org/buildbot/builders/deb2%20-%20static_interfaces/builds/289 blamelist: Sergey Lisitsyn <lisitsyn.s.o@gmail.com>, Viktor Gal <viktor.gal@maeth.com> | 15:06 |
| pluskid | :( completely no idea what nice figure to create | 15:09 |
| -!- yoo [2eda6d52@gateway/web/freenode/ip.46.218.109.82] has quit [Quit: Page closed] | 15:28 | |
| -!- pluskid [72f6b3c3@gateway/web/freenode/ip.114.246.179.195] has quit [Quit: Page closed] | 16:03 | |
| -!- vojtech [9320543b@gateway/web/freenode/ip.147.32.84.59] has quit [Quit: Page closed] | 17:15 | |
| -!- zxtx [~zv@70.99.151.251] has joined #shogun | 17:27 | |
| -!- uricamic [~uricamic@2001:718:2:1634:876:e01f:ab62:a2a] has quit [Quit: Leaving.] | 17:37 | |
| -!- yoo [2eda6d52@gateway/web/freenode/ip.46.218.109.82] has joined #shogun | 17:54 | |
| -!- yoo [2eda6d52@gateway/web/freenode/ip.46.218.109.82] has quit [Client Quit] | 17:54 | |
| @sonney2k | gsomix, yes? | 18:00 |
| gsomix | sonney2k, nevermind. :) | 18:00 |
| wiking | !@#$ | 18:15 |
| CIA-21 | shogun: Viktor Gal master * rae2ea5c / src/configure : Detect gmock framework without gmock-config - http://git.io/cHveXQ | 18:25 |
| CIA-21 | shogun: Heiko Strathmann master * reecb090 / src/configure : Merge pull request #721 from vigsterkr/utest - http://git.io/6ixrTA | 18:25 |
| wiking | i hope heiko will manage to get this work | 18:25 |
| wiking | :) | 18:25 |
| CIA-21 | shogun: Michal Uricar master * r4f930ca / (12 files in 2 dirs): BMRM training exception fixed + several warning fixes - http://git.io/GVtDZQ | 18:26 |
| CIA-21 | shogun: Heiko Strathmann master * rf28f0ee / (12 files in 2 dirs): Merge pull request #723 from uricamic/BM_SOL_EXAMPLE - http://git.io/V_YmHg | 18:26 |
| -!- blackburn [~blackburn@62.106.106.114] has joined #shogun | 18:39 | |
| wiking | blackburn: got 10 mins for testing? | 18:53 |
| blackburn | wiking: yeah | 18:53 |
| blackburn | testing of what? | 18:53 |
| wiking | blackburn: u have the latest ubuntu right? | 18:53 |
| blackburn | yes | 18:53 |
| wiking | ok just a sec to cehck out something | 18:54 |
| wiking | ok | 18:54 |
| wiking | so can u download compile& install this | 18:54 |
| wiking | http://googletest.googlecode.com/files/gtest-1.6.0.zip | 18:54 |
| wiking | as u won't have package of it | 18:54 |
| blackburn | okay let me try | 18:55 |
| wiking | ah before | 18:55 |
| wiking | do this | 18:55 |
| wiking | sudo apt-get install google-mock | 18:55 |
| wiking | and once ready check out the HEAD of shogun/master | 18:56 |
| wiking | and try to run ./configure script | 18:56 |
| wiking | and give --libs=<where u've installed libgtest> | 18:56 |
| wiking | and paste here what's the output of ./configure script for google c++ mocking framework | 18:57 |
| wiking | should work ;) | 18:57 |
| shogun-buildbot_ | build #363 of deb3 - modular_interfaces is complete: Failure [failed test python_modular] Build details are at http://www.shogun-toolbox.org/buildbot/builders/deb3%20-%20modular_interfaces/builds/363 blamelist: Viktor Gal <viktor.gal@maeth.com> | 18:57 |
| blackburn | omg | 18:58 |
| blackburn | again | 18:58 |
| blackburn | :D | 18:58 |
| wiking | :) | 18:58 |
| wiking | i don't know what's with serialization | 18:58 |
| blackburn | echo "'make install' is dangerous and not supported | 18:58 |
| wiking | but bmrm should work in the next build | 18:58 |
| wiking | due to uricamic's fixes | 18:58 |
| shogun-buildbot_ | build #290 of deb2 - static_interfaces is complete: Failure [failed test cmdline_static] Build details are at http://www.shogun-toolbox.org/buildbot/builders/deb2%20-%20static_interfaces/builds/290 blamelist: Heiko Strathmann <heiko.strathmann@gmail.com>, Michal Uricar <uricar.michal@gmail.com>, Viktor Gal <viktor.gal@maeth.com> | 19:00 |
| wiking | blackburn: ?! | 19:00 |
| wiking | blackburn: not supported? :))) you cannot install it under /usr/local/ ? | 19:00 |
| blackburn | wiking: so how can I install gtest to some default dir | 19:01 |
| wiking | good question | 19:01 |
| wiking | i'm trying on some other machine now :) | 19:02 |
| wiking | ok | 19:03 |
| wiking | well this is rather a huge hack | 19:03 |
| wiking | but fuck it i mean i don't know what were actually ubuntu people thinking to supply a -dev package of a library w/o the actual library | 19:03 |
| blackburn | :D | 19:03 |
| wiking | sudo cp lib/.libs/libgtest.so* /usr/local/lib | 19:04 |
| wiking | sudo cp lib/.libs/libgtest_main.so* /usr/loca/lib | 19:04 |
| wiking | that should do the trick | 19:04 |
| blackburn | heh | 19:04 |
| wiking | and then: in shogun/src | 19:05 |
| wiking | ./configure --libs=/usr/local/lib | 19:05 |
| blackburn | 346 /usr/lib/gcc/x86_64-linux-gnu/4.6/../../../../lib/libgmock.so: undefined reference to `pthread_key_create' | 19:10 |
| blackburn | 347 /usr/lib/gcc/x86_64-linux-gnu/4.6/../../../../lib/libgmock.so: undefined reference to `pthread_getspecific' | 19:10 |
| blackburn | 348 /usr/lib/gcc/x86_64-linux-gnu/4.6/../../../../lib/libgmock.so: undefined reference to `pthread_key_delete' | 19:10 |
| blackburn | 349 /usr/lib/gcc/x86_64-linux-gnu/4.6/../../../../lib/libgmock.so: undefined reference to `pthread_setspecific' | 19:10 |
| blackburn | wiking: should I compile it w/o thread support or so? | 19:10 |
| wiking | ooooh motherfucker :)) | 19:10 |
| wiking | can u paste me the part of configure.log about gmock | 19:11 |
| wiking | ? | 19:11 |
| blackburn | wiking: ^ that's it | 19:11 |
| wiking | the whole | 19:12 |
| wiking | :) | 19:12 |
| wiking | with the cc line an eerything | 19:12 |
| blackburn | http://pastebin.com/qYd8MsHN | 19:12 |
| wiking | do u still have the ./configure-229-20517.cpp file? | 19:13 |
| blackburn | no | 19:13 |
| wiking | ok just a test | 19:14 |
| wiking | in ./configure script | 19:14 |
| wiking | GMOCK_LDADD="-lgmock -lgtest" | 19:14 |
| wiking | replace it with | 19:14 |
| blackburn | -pthread | 19:14 |
| blackburn | yeah | 19:14 |
| wiking | GMOCK_LDADD="-lgmock -lgtest -lpthread" | 19:14 |
| blackburn | :D | 19:14 |
| wiking | yeah | 19:14 |
| wiking | but i think you'll have to add still one thing | 19:15 |
| wiking | -D_THREAD_SAFE | 19:15 |
| blackburn | add to? | 19:15 |
| wiking | GMOCK_LDADD="-lgmock -lgtest -lpthread -D_THREAD_SAFE" | 19:15 |
| blackburn | well it is detected now | 19:15 |
| wiking | so do it like that | 19:16 |
| wiking | try to compile the whole libshogun | 19:16 |
| wiking | or just type: make unit-tests | 19:16 |
| wiking | should compile libshogun | 19:16 |
| wiking | and then run the unit tests | 19:16 |
| wiking | lol | 19:17 |
| wiking | ../shogun/lib/versionstring.h:3:27: note: expanded from macro 'VERSION_REVISION' | 19:17 |
| wiking | #define VERSION_REVISION 0x | 19:17 |
| wiking | wtf :D | 19:17 |
| wiking | works? | 19:20 |
| wiking | or still compiling :) | 19:20 |
| blackburn | still | 19:20 |
| CIA-21 | shogun: Viktor Gal master * r6a96d7e / src/configure : Fix GMOCK_LDADD flags - http://git.io/58Gpaw | 19:24 |
| CIA-21 | shogun: Sergey Lisitsyn master * rbfd1965 / src/configure : Merge pull request #724 from vigsterkr/latent - http://git.io/wu8-1g | 19:24 |
| wiking | let'shope it works now :)) | 19:24 |
| wiking | ok new PR for fixing some doxygen warnings | 19:28 |
| wiking | https://github.com/shogun-toolbox/shogun/pull/725 | 19:28 |
| CIA-21 | shogun: Viktor Gal master * rb7037d3 / (3 files): Fix doxygen comments in structure - http://git.io/GpUrpg | 19:29 |
| CIA-21 | shogun: Sergey Lisitsyn master * r271aeed / (3 files): Merge pull request #725 from vigsterkr/so - http://git.io/G8LrQQ | 19:29 |
| wiking | no unit tests yet? :) | 19:29 |
| blackburn | I forgot to | 19:30 |
| blackburn | compile only libshogun | 19:30 |
| blackburn | :D | 19:30 |
| blackburn | last interface to go | 19:31 |
| wiking | yey | 19:31 |
| shogun-buildbot_ | build #364 of deb3 - modular_interfaces is complete: Failure [failed test python_modular] Build details are at http://www.shogun-toolbox.org/buildbot/builders/deb3%20-%20modular_interfaces/builds/364 blamelist: Heiko Strathmann <heiko.strathmann@gmail.com>, Michal Uricar <uricar.michal@gmail.com> | 19:35 |
| wiking | again? :) | 19:35 |
| blackburn | wiking: I was thinking about static analysis of code | 19:51 |
| wiking | blackburn: so? | 19:51 |
| blackburn | have an opinion on that? | 19:51 |
| wiking | compiled? | 19:51 |
| wiking | or what's happening :) | 19:51 |
| blackburn | I mean we could use static analysis to track some bugs | 19:51 |
| blackburn | treehydra would work | 19:52 |
| blackburn | or sparse | 19:52 |
| blackburn | do you have any experience in that? | 19:52 |
| wiking | mm not really | 19:53 |
| wiking | how's your unit testing? | 19:53 |
| blackburn | will try in a minute | 19:53 |
| wiking | ok | 19:54 |
| wiking | there's one coming with clang | 19:54 |
| wiking | http://clang-analyzer.llvm.org/ | 19:54 |
| wiking | pretty cool | 19:54 |
| wiking | i've tried it couple of times | 19:54 |
| blackburn | SGVectorTest.misc failed | 19:56 |
| wiking | oh cool why :) | 19:57 |
| blackburn | lib/SGVector_unittest.cc:136: Failure | 19:58 |
| blackburn | Value of: b[i]+1.3*b[i] | 19:58 |
| blackburn | Actual: -1931.74 | 19:58 |
| blackburn | Expected: d[i] | 19:58 |
| blackburn | Which is: -1931.74 | 19:58 |
| blackburn | lib/SGVector_unittest.cc:136: Failure | 19:58 |
| blackburn | Value of: b[i]+1.3*b[i] | 19:58 |
| blackburn | Actual: -819.947 | 19:58 |
| blackburn | Expected: d[i] | 19:58 |
| blackburn | Which is: -819.947 | 19:58 |
| wiking | mmm that is funny | 19:58 |
| wiking | :)))) | 19:58 |
| wiking | since they seemed to be the same value | 19:58 |
| blackburn | precision issue? | 19:58 |
| wiking | all the others passed? | 19:58 |
| blackburn | yes | 19:58 |
| wiking | can u run it again? | 19:59 |
| blackburn | works | 19:59 |
| blackburn | no | 19:59 |
| blackburn | no | 19:59 |
| blackburn | no | 19:59 |
| wiking | ? | 19:59 |
| wiking | what? | 19:59 |
| wiking | :) | 19:59 |
| blackburn | no | 20:00 |
| blackburn | no | 20:00 |
| blackburn | :D | 20:00 |
| wiking | what what what | 20:00 |
| blackburn | worked once | 20:00 |
| wiking | hahaha | 20:00 |
| blackburn | computing probability | 20:00 |
| wiking | ok then there's some precisiou problem | 20:00 |
| wiking | i'm just running that checker stuff on shogun | 20:01 |
| wiking | it has some funny reports ;) | 20:01 |
| blackburn | wiking: clang one? | 20:01 |
| wiking | yeps | 20:01 |
| wiking | i'll put the report somewhere | 20:01 |
| blackburn | yeah interesting to see | 20:01 |
| wiking | just let it finish | 20:01 |
| wiking | compilation is much slower of course | 20:01 |
| wiking | ../shogun/mathematics/Math.h:372:19: warning: Array access (from variable 'xy') results in a null pointer dereference area += 0.5*(xy[2*i]-xy[2*(i-1)])*(xy[2*i+1]+xy[2*(i-1)+1]); | 20:02 |
| wiking | :) | 20:02 |
| blackburn | I know the method probably | 20:02 |
| blackburn | can't agree with analyzer | 20:03 |
| wiking | heheh funny ones | 20:06 |
| wiking | kernel/Kernel.cpp:530:34: warning: Division by zero | 20:06 |
| wiking | (int32_t)(kernel_cache.buffsize/kernel_cache.activenum); | 20:06 |
| wiking | ~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~ | 20:06 |
| wiking | kernel/Kernel.cpp:862:27: warning: Array access (via field 'vector') results in a null pointer dereference combined_kernel_weight = weights.vector[0] ; | 20:06 |
| shogun-buildbot_ | build #365 of deb3 - modular_interfaces is complete: Failure [failed test python_modular] Build details are at http://www.shogun-toolbox.org/buildbot/builders/deb3%20-%20modular_interfaces/builds/365 blamelist: Sergey Lisitsyn <lisitsyn.s.o@gmail.com>, Viktor Gal <viktor.gal@maeth.com> | 20:11 |
| blackburn | okay this 530 one is not a bug | 20:11 |
| blackburn | but good it points it | 20:11 |
| blackburn | that* | 20:11 |
| wiking | blackburn: is there a check for kernel_cache.activenum != 0? | 20:12 |
| shogun-buildbot_ | build #291 of deb2 - static_interfaces is complete: Failure [failed test cmdline_static] Build details are at http://www.shogun-toolbox.org/buildbot/builders/deb2%20-%20static_interfaces/builds/291 blamelist: Sergey Lisitsyn <lisitsyn.s.o@gmail.com>, Viktor Gal <viktor.gal@maeth.com> | 20:13 |
| blackburn | wiking: it just should not happend but no, no check | 20:13 |
| wiking | blackburn: well then at least an ASSERT() | 20:14 |
| wiking | if it should not happen | 20:14 |
| blackburn | that's a good thing I should say | 20:14 |
| -!- Marina_ [5ce7df29@gateway/web/freenode/ip.92.231.223.41] has joined #shogun | 20:14 | |
| wiking | ok | 20:14 |
| wiking | i have the report | 20:14 |
| blackburn | let me see full report of that thing | 20:14 |
| wiking | let me check how i can share it | 20:14 |
| blackburn | I will put a few asserts | 20:14 |
| Marina_ | hello, can anyone help me by the arts application? i get the following error when by running art.py: | 20:15 |
| Marina_ | Usage: arts.py [options] seq.fa arts.py: error: incorrect number of arguments | 20:15 |
| blackburn | Marina_: how do you execute it? | 20:16 |
| blackburn | exact command line string I mean | 20:16 |
| Marina_ | python arts.py | 20:17 |
| wiking | blackburn: http://maeth.com/shogun-report/ | 20:17 |
| blackburn | you should provide some sequence files for that | 20:17 |
| blackburn | wiking: cool thanks | 20:18 |
| wiking | blackburn: have fun :) should i post it on mailinglist? | 20:18 |
| blackburn | Marina_: e.g. ./arts.py data/ARTS.dat.bz2 | 20:18 |
| blackburn | oh it fails in current build :D | 20:19 |
| Marina_ | ah ok, i try | 20:19 |
| Marina_ | hist[255]=4763 get_num_bits_in_histogram()=8 > get_num_bits()=2 [ERROR] ALPHABET too small to contain all symbols in histogram Traceback (most recent call last): File "arts.py", line 64, in <module> preds = arts.predict(seq) File "/home/mvidovic/POIM/ARTS/signal_sensor.py", line 199, in predict f = self.sensors[i].get_test_features(chunk, self.window) File "/home/mvidovic/POIM/ARTS/signal_sensor.py", line 104, in get_te | 20:21 |
| Marina_ | i got this error | 20:21 |
| Marina_ | can you help me? | 20:21 |
| blackburn | yes | 20:21 |
| blackburn | will try to | 20:21 |
| wiking | blackburn: heheh nice memory leak reports :) | 20:22 |
| wiking | blackburn: there's on in slep | 20:22 |
| blackburn | yeah | 20:22 |
| wiking | mmm i guess it would be a good idea to have this automatically generated :) | 20:24 |
| blackburn | exactly | 20:24 |
| wiking | mmm should we set it up somewhere ?:) | 20:27 |
| wiking | i mean of course it depends as well which static analyser we want to use | 20:28 |
| wiking | i used this one because i had it at hand | 20:28 |
| blackburn | Marina_: okay I recall I tried to fix that but do not remember the root cause | 20:28 |
| blackburn | I will check now and try to fix | 20:28 |
| Marina_ | thank you!! | 20:31 |
| Marina_ | the arts programm will show me the important transcription starts, or? | 20:32 |
| blackburn | Marina_: I'd like to help you if I knew anything about transcription starts or anything like that :D | 20:33 |
| Marina_ | :-) | 20:33 |
| blackburn | it detects something and it fails on creating string features | 20:33 |
| blackburn | that's what I know | 20:33 |
| blackburn | :D | 20:34 |
| Marina_ | thats super - thats enough ;-) | 20:36 |
| blackburn | interesting | 20:37 |
| wiking | blackburn: so nullpointer dereferencing fixes are coming up from u ?:) | 20:40 |
| blackburn | yes everything from me | 20:40 |
| wiking | :>>> | 20:40 |
| wiking | blackburn: i'll fix the so part | 20:40 |
| blackburn | ah ok | 20:40 |
| wiking | the memleaks | 20:40 |
| wiking | blackburn: what should be with the Undefined allocation of 0 bytes (CERT MEM04-C; CWE-131) errors? :) | 20:47 |
| blackburn | wiking: no idea what it is | 20:47 |
| wiking | well that it can happen that u call malloc with 0 bytes | 20:48 |
| blackburn | hmm just assert it then | 20:48 |
| wiking | ok i think i'll push this mem leak fix | 20:53 |
| wiking | but i need uricamic to comment on it | 20:53 |
| wiking | so don't merge it | 20:53 |
| blackburn | ok | 20:54 |
| blackburn | Marina_: hah okay it was my bad | 20:54 |
| blackburn | it works ok - I just said wrong thing | 20:54 |
| Marina_ | ok | 20:54 |
| blackburn | Marina_: you need to put a fasta file after ./arts.py | 20:54 |
| Marina_ | which should i use? | 20:55 |
| blackburn | well the one you want to detect (something) in | 20:56 |
| blackburn | afaik by default it uses trained model | 20:56 |
| blackburn | from that file | 20:56 |
| Marina_ | but thats the file we used -- data/ARTS.dat.bz2 | 20:57 |
| blackburn | no, it is a model and it is loaded by default | 20:57 |
| blackburn | you need to specify fasta file containing sequencies you want to work with | 20:57 |
| blackburn | ah | 20:58 |
| blackburn | it works with single sequence | 20:58 |
| blackburn | okay updated | 20:58 |
| Marina_ | is there any example for such a file -- how the input have to be`? | 20:59 |
| blackburn | Marina_: for example you need to detect what it detects in some sequence | 20:59 |
| blackburn | yes | 20:59 |
| blackburn | just sequences | 20:59 |
| blackburn | in line | 20:59 |
| blackburn | sequence* sorry | 21:00 |
| blackburn | so just create some file file.fa and put some sequence | 21:00 |
| blackburn | and ./arts.py file.fa will do something with trained model | 21:00 |
| Marina_ | i try --- thanks!! | 21:00 |
| blackburn | I should learn about bioinf more :D | 21:01 |
| blackburn | however it is kind of legacy for us now | 21:01 |
| wiking | looooooooooooooool | 21:02 |
| wiking | this is really heavy weaight | 21:02 |
| wiking | weight | 21:02 |
| wiking | http://maeth.com/shogun-report/report-kbc54l.html#EndPath | 21:02 |
| wiking | :DD | 21:02 |
| wiking | i think i've found the bug why the multiclass results were not so good :DDD | 21:03 |
| blackburn | really? | 21:03 |
| blackburn | why? | 21:03 |
| wiking | check that link | 21:03 |
| wiking | and you'll see | 21:03 |
| wiking | SO multiclass i mean | 21:03 |
| wiking | blackburn: got it? :) | 21:04 |
| blackburn | ehm | 21:05 |
| blackburn | if score > max_score | 21:05 |
| blackburn | then | 21:05 |
| blackburn | score = max_score | 21:05 |
| blackburn | INTERESTING | 21:05 |
| blackburn | it provides nice output | 21:05 |
| blackburn | we must have it on buildbot | 21:05 |
| wiking | blackburn: and then on the end | 21:06 |
| wiking | max_score is used | 21:06 |
| blackburn | yeah let me fix it | 21:06 |
| wiking | i'll fix it :) | 21:06 |
| wiking | i'm in structure :D | 21:06 |
| blackburn | ah ok | 21:06 |
| wiking | fuck | 21:06 |
| wiking | this shit is good | 21:06 |
| wiking | :))) | 21:06 |
| wiking | we need this shit running automatically | 21:06 |
| Marina_ | mhh, i have put 2 sequences into testfile.fa : ACCTTTTTGAAAA and TTTTATACCATAT and there comes the error | 21:07 |
| wiking | n4nd0 where are you!? | 21:07 |
| Marina_ | loading model file......................done number of chunks for contig: 1 processing chunk #0 [ERROR] assertion max_string_length>=window_size || (single_string && length_of_single_string>=window_size) failed in file features/StringFeatures.cpp line 1197 Traceback (most recent call last): File "arts.py", line 64, in <module> preds = arts.predict(seq) File "/home/mvidovic/POIM/ARTS/signal_sensor.py", line 199, in predict | 21:07 |
| blackburn | Marina_: it should be bigger | 21:07 |
| blackburn | Marina_: your string has lenght less than window size | 21:08 |
| Marina_ | oh :-) | 21:08 |
| blackburn | let me find the window size | 21:08 |
| wiking | blackburn: i've requested uricamic to comment on that PR... let's hope he agrees | 21:08 |
| blackburn | okay | 21:11 |
| wiking | blackburn: i wonder if ASSERT will remove these nullpointer dereferencing errors | 21:13 |
| blackburn | well it should | 21:13 |
| blackburn | wiking: one bad thing about require macro - it has to be in { } with if | 21:18 |
| blackburn | in other case it will be expanded to if if | 21:18 |
| blackburn | if () REQUIRE() else ... will produce if () if () else | 21:19 |
| wiking | man this bug is crazy :)) | 21:21 |
| blackburn | which? | 21:21 |
| wiking | this with max_score :) | 21:21 |
| wiking | i'll have to see the difrerence | 21:22 |
| blackburn | Marina_: oops sorry | 21:23 |
| blackburn | format is | 21:23 |
| blackburn | > anything | 21:24 |
| blackburn | and then sequence | 21:24 |
| blackburn | so fasta with single file | 21:24 |
| Marina_ | ? i dont understand | 21:24 |
| Marina_ | anything? | 21:24 |
| Marina_ | can you spot the right window_size? | 21:25 |
| blackburn | it is 140 | 21:25 |
| blackburn | with default model | 21:25 |
| Marina_ | ah thanks | 21:25 |
| Marina_ | and what do you mean with : | 21:25 |
| Marina_ | anything [21:23] <blackburn> and then sequence | 21:25 |
| wiking | shit with the fucking mosek :DDD | 21:26 |
| blackburn | > 0 label=1 | 21:26 |
| blackburn | ACTGGGATAATTTGAAACAATAAATTTTTTTTTGAATTGTAGGTGTCCTGCTTGCATCCA | 21:26 |
| blackburn | AAGGAGTCGATGATGTTGAGCA | 21:26 |
| blackburn | Marina_: ^ | 21:26 |
| blackburn | but sequence should have length greater than 140 | 21:26 |
| blackburn | will not work with tweets :D | 21:26 |
| blackburn | wiking: great idea to tweet something like that ^, right? :D | 21:29 |
| wiking | :DDD | 21:30 |
| blackburn | wiking: ACTGCCATTACGCA! | 21:30 |
| Marina_ | now i get an assertion error: loading model file......................done Traceback (most recent call last): File "arts.py", line 64, in <module> preds = arts.predict(seq) File "/home/mvidovic/POIM/ARTS/signal_sensor.py", line 180, in predict assert(num_chunks > 0) AssertionError | 21:30 |
| blackburn | Marina_: okay that's a different thing now :D | 21:30 |
| wiking | LOFASZ! | 21:31 |
| wiking | moseking | 21:31 |
| wiking | 8-aug-2012 | 21:32 |
| wiking | yeey | 21:32 |
| wiking | need a new license | 21:32 |
| wiking | wtf | 21:35 |
| wiking | SO-SVM: 90.30 | 21:36 |
| wiking | MC: 50.00 | 21:36 |
| wiking | hahahaha | 21:36 |
| blackburn | heh | 21:36 |
| Marina_ | whats wrong now? what can i do? | 21:36 |
| wiking | i think n4nd0 will be happy | 21:36 |
| wiking | :))) | 21:36 |
| wiking | let's see with the old code | 21:36 |
| wiking | :) | 21:36 |
| blackburn | Marina_: nothing yet | 21:37 |
| Marina_ | ? | 21:38 |
| wiking | comeoooooon COMPILE BITCH! | 21:38 |
| -!- gsomix_ [~gsomix@109.169.155.206] has joined #shogun | 21:38 | |
| blackburn | Marina_: I am checking what can I do :) | 21:38 |
| Marina_ | thanks blackburn | 21:39 |
| wiking | duuuuuuuuuuuuuuuuuuuuuuuuude | 21:41 |
| wiking | SO-SVM: 36.20 | 21:41 |
| wiking | MC: 46.80 | 21:41 |
| wiking | :DDD | 21:41 |
| wiking | n4nd0 owes me a beer | 21:41 |
| wiking | :) | 21:41 |
| -!- gsomix [~gsomix@95.67.191.15] has quit [Ping timeout: 272 seconds] | 21:42 | |
| wiking | motherfucker | 21:42 |
| wiking | i fucked it up | 21:42 |
| wiking | with the PRs | 21:42 |
| wiking | ok i'm closing 726 | 21:42 |
| blackburn | what did you break? | 21:45 |
| wiking | nothing.. just added the 2 separate commits into one pr | 21:45 |
| wiking | fixing it | 21:46 |
| blackburn | Marina_: okay it worked with sequence of length ~2500 and small patch | 21:49 |
| wiking | yey https://github.com/shogun-toolbox/shogun/pull/728 | 21:50 |
| wiking | blackburn: so great idea for the static analyzer ;) | 21:51 |
| CIA-21 | shogun: Viktor Gal master * r2bd9905 / src/shogun/structure/MulticlassModel.cpp : Fix argmax function in MulticlassModel - http://git.io/mVqOdA | 21:51 |
| CIA-21 | shogun: Sergey Lisitsyn master * r7eb8b72 / src/shogun/structure/MulticlassModel.cpp : Merge pull request #728 from vigsterkr/latent - http://git.io/WmOWFw | 21:51 |
| Marina_ | blackburn: what do you mean by small patch? | 21:51 |
| blackburn | Marina_: I will commit it in a sec | 21:51 |
| blackburn | Marina_: here it goes, please update git | 21:52 |
| CIA-21 | shogun: Sergey Lisitsyn master * r4c4d431 / applications/arts/signal_sensor.py : Added probably missed kernel setting in arts - http://git.io/T5b_5Q | 21:52 |
| blackburn | ^ | 21:52 |
| -!- puffin444 [6c646990@gateway/web/freenode/ip.108.100.105.144] has joined #shogun | 21:55 | |
| puffin444 | hey blackburn, hows it going? | 21:56 |
| blackburn | puffin444: hey puffin444 | 21:56 |
| blackburn | whoa that was recursive | 21:57 |
| blackburn | puffin444: I wanted to ask a few thing | 21:57 |
| blackburn | s | 21:57 |
| puffin444 | lol how was the meeting? | 21:57 |
| puffin444 | oh sure | 21:57 |
| blackburn | well we were having vodka and dance a little | 21:58 |
| blackburn | I completely missed your gradient evaluation stuff | 21:58 |
| blackburn | is that the thing that learns a gp on top of results? | 21:58 |
| blackburn | or is that model selection for gps? | 21:58 |
| puffin444 | what do you need concerning gtadient evaluation? | 21:59 |
| blackburn | what is the method | 21:59 |
| puffin444 | they are the same | 21:59 |
| blackburn | :D | 22:00 |
| Marina_ | blackburn: the assertion error is still there | 22:00 |
| blackburn | can that work for svm? | 22:00 |
| blackburn | Marina_: what is length of your sequence? | 22:00 |
| puffin444 | assertion error? | 22:00 |
| Marina_ | 2500 | 22:01 |
| blackburn | hmm | 22:01 |
| blackburn | that's pretty strange, okay | 22:01 |
| blackburn | Marina_: how your input file look like? can you paste it via http://pastebin.com/? | 22:02 |
| blackburn | puffin444: so can that work with general machine? | 22:02 |
| blackburn | or is that the thing to select parameters for gp regression machine? | 22:02 |
| puffin444 | the gradient framework should be applicable to anything with a differentiable function class | 22:03 |
| blackburn | any example of that? | 22:03 |
| Marina_ | ahhhh it works | 22:03 |
| puffin444 | if you encounter problems with it, please let me know | 22:03 |
| blackburn | nice to hear | 22:03 |
| blackburn | puffin444: can I learn svm's C with that? | 22:04 |
| puffin444 | I have not tried it with something other than a gp | 22:04 |
| Marina_ | thank you very much blackburn | 22:04 |
| blackburn | there is no gradient for sure, but what are other examples of differentiable evaluations? | 22:04 |
| blackburn | Marina_: no problem, let me know if there are more problems with it | 22:05 |
| puffin444 | but it should work in theory as long as it can work with the interface | 22:05 |
| blackburn | puffin444: okay other issue | 22:05 |
| puffin444 | no examples yet except for inference method class | 22:05 |
| puffin444 | yes? | 22:06 |
| blackburn | hmm | 22:06 |
| blackburn | there was a class with eigen members | 22:06 |
| blackburn | did you fix that already? | 22:06 |
| puffin444 | yes that should be fitcinference method | 22:07 |
| -!- n4nd0 [~nando@98.Red-2-137-39.dynamicIP.rima-tde.net] has joined #shogun | 22:07 | |
| blackburn | aha | 22:07 |
| blackburn | n4nd0: he | 22:07 |
| blackburn | y | 22:07 |
| blackburn | puffin444: can we avoid it somehow? | 22:07 |
| n4nd0 | blackburn: hey! | 22:08 |
| n4nd0 | wiking: thank you for the bug | 22:08 |
| wiking | n4nd0: heavy shit :D | 22:08 |
| puffin444 | errors? warnings? I found no errors on my machine, but there are warnings that appear to come from an incorrect config on my box | 22:08 |
| n4nd0 | BTW there is another bug I found this morning | 22:08 |
| n4nd0 | wiking: :D | 22:08 |
| wiking | n4nd0: but now it performs really good :)))) | 22:08 |
| puffin444 | no more eigen? | 22:08 |
| n4nd0 | cool | 22:08 |
| wiking | n4nd0: but never would have found it w/o blackburn's idea to do a static analysis | 22:08 |
| blackburn | puffin444: I mean if we have eigen in headers it has to be in included path | 22:08 |
| n4nd0 | wiking, blackburn: then I own you both a beer :) | 22:09 |
| wiking | :P | 22:09 |
| n4nd0 | blackburn: it can be vodka too :P | 22:09 |
| blackburn | puffin444: if it is in .cpp - it is not a dependency | 22:09 |
| blackburn | see what I mean? | 22:09 |
| puffin444 | yes. dont I use just the .h file from shogun though? do I directly reference eigen anywhere? | 22:10 |
| blackburn | puffin444: I am not sure I got what you mean | 22:10 |
| puffin444 | oh sry you mean in the cpp files | 22:10 |
| blackburn | puffin444: easiest solution I have in mind is to use Map from eigen | 22:11 |
| blackburn | do you know how to use it? | 22:11 |
| puffin444 | not sure | 22:11 |
| wiking | :>> | 22:12 |
| blackburn | puffin444: for example Map<VectorXd> somevector(pointer); will produce something that acts just like VectorXd | 22:12 |
| puffin444 | so should I just reference the cmap header if I want to use eigen? | 22:13 |
| puffin444 | oh ok | 22:13 |
| blackburn | puffin444: this way you can map SGMatrices to eigen ones | 22:13 |
| puffin444 | oh I see so that I can just use one set instead of having both eigen and shogun matrices | 22:14 |
| blackburn | puffin444: we have to avoid eigen members because in other way we have to add eigen include path everywhere - in tests/examples and even add a dependency in .deb package | 22:14 |
| blackburn | yeah just map it with Map<> | 22:15 |
| puffin444 | I go ahead and work on this. by the way I have a tuorial underway | 22:15 |
| blackburn | puffin444: here comes the example - http://eigen.tuxfamily.org/dox/TutorialMapClass.html | 22:16 |
| puffin444 | sorry if I was absent the last few days. I had to pack up and I am currently on route to Pittsburgh | 22:16 |
| blackburn | I see | 22:16 |
| puffin444 | where should I put the tutorial under shogun-tutorial? | 22:18 |
| -!- Marina_ [5ce7df29@gateway/web/freenode/ip.92.231.223.41] has quit [Quit: Page closed] | 22:18 | |
| blackburn | puffin444: well did you check available structure? | 22:19 |
| CIA-21 | shogun: Evgeniy Andreev master * rd3f9d75 / (6 files in 3 dirs): added design of zero-copy methods - http://git.io/EghHzg | 22:19 |
| CIA-21 | shogun: Sergey Lisitsyn master * rc6792c3 / (6 files in 3 dirs): Merge pull request #722 from gsomix/buffer_protocol - http://git.io/pfEZ5w | 22:19 |
| puffin444 | yes I think it should go under algorithms but not sure | 22:19 |
| blackburn | yeah put it to algorithms | 22:20 |
| blackburn | anyway changing structure is so much easier task than writing a book :D | 22:20 |
| wiking | n4nd0: check on the report that i've sent to the mailing list.. i think there won't be any more such big bugs, but would be nice to eliminate those reports before the 2.0 release | 22:21 |
| puffin444 | oh one last thing- any issues with the Laplacian PR? | 22:21 |
| shogun-buildbot_ | build #366 of deb3 - modular_interfaces is complete: Failure [failed test python_modular] Build details are at http://www.shogun-toolbox.org/buildbot/builders/deb3%20-%20modular_interfaces/builds/366 blamelist: Viktor Gal <viktor.gal@maeth.com> | 22:22 |
| blackburn | puffin444: I've waited for other commits but if it can go - please rebase and I will merge | 22:22 |
| n4nd0 | wiking: I have read this static analysis, although I have not gone through the report. I'll do that | 22:22 |
| n4nd0 | good idea btw! | 22:22 |
| wiking | n4nd0: yeah i think w/o this we would be debugging MulticlassModel for a while to find out why is it so bad :) | 22:23 |
| puffin444 | I will do asap. I am currently on route to Pittsburgh so it may take some time before I can rebase | 22:23 |
| n4nd0 | wiking: hehe yes | 22:24 |
| blackburn | puffin444: no reason to hurry :) | 22:24 |
| shogun-buildbot_ | build #292 of deb2 - static_interfaces is complete: Failure [failed test cmdline_static] Build details are at http://www.shogun-toolbox.org/buildbot/builders/deb2%20-%20static_interfaces/builds/292 blamelist: Sergey Lisitsyn <lisitsyn.s.o@gmail.com>, Viktor Gal <viktor.gal@maeth.com> | 22:24 |
| blackburn | puffin444: did they put your massive notebook into a special car? | 22:24 |
| blackburn | :D | 22:24 |
| blackburn | oh gosh | 22:24 |
| puffin444 | lol no, but the gas mileage is pretty bad :) | 22:25 |
| -!- zxtx [~zv@70.99.151.251] has quit [Ping timeout: 240 seconds] | 22:25 | |
| blackburn | are you driving a car just now? :D | 22:25 |
| blackburn | this can be dangerous unless you have well-trained structured output SVM | 22:26 |
| puffin444 | goodness no lol thankfully my father is helping me move | 22:26 |
| blackburn | send him a hello from soviet russia :D | 22:27 |
| puffin444 | I will :). | 22:27 |
| CIA-21 | shogun: Sergey Lisitsyn master * r11b38ab / examples/undocumented/cmdline_static/regression_krr.sg : Fixed KRR example - http://git.io/v7foig | 22:27 |
| puffin444 | ok Blackburn I have to go. I hope to come back and work on these things asap. | 22:29 |
| blackburn | puffin444: no need for asap :) | 22:30 |
| -!- puffin444 [6c646990@gateway/web/freenode/ip.108.100.105.144] has quit [Quit: Page closed] | 22:30 | |
| CIA-21 | shogun: Sergey Lisitsyn master * rc727079 / data : Updated data submodule - http://git.io/esMg3g | 22:31 |
| wiking | blackburn: | 22:33 |
| wiking | git submodule update [wiking@welitron:~/shogun/] | 22:33 |
| wiking | fatal: reference is not a tree: 874abd8a2269380c6e15c4bdadda697a8b81c987 | 22:33 |
| wiking | Unable to checkout '874abd8a2269380c6e15c4bdadda697a8b81c987' in submodule path 'data' | 22:33 |
| blackburn | now? | 22:34 |
| wiking | still | 22:34 |
| blackburn | wiking: are your data up to date? | 22:34 |
| wiking | blackburn: that's what i'm trying to do | 22:34 |
| wiking | update it | 22:34 |
| blackburn | what if you go to the folder and update? | 22:35 |
| wiking | it's not working like that | 22:35 |
| wiking | it's not an actuall branch | 22:35 |
| wiking | it's just a reference to a given commit | 22:35 |
| wiking | i mean git submodule should not work like that | 22:35 |
| blackburn | I don't know then | 22:35 |
| wiking | it's not as if you have a given branch checked out into a subdir... | 22:35 |
| wiking | who wrote the mosek detection in mosek? | 22:37 |
| wiking | i mean in configure script? | 22:37 |
| blackburn | I did IIRC | 22:37 |
| blackburn | feel free to improve :D | 22:37 |
| n4nd0 | wiking: anyway, let me ask you - what example do you run when you test the MulticlassModel? | 22:37 |
| wiking | blackburn: did it work for you? | 22:38 |
| wiking | n4nd0: yours | 22:38 |
| wiking | n4nd0: so_multiclass | 22:38 |
| n4nd0 | so_multiclass.cpp? | 22:38 |
| blackburn | would it be a surprise if I said I didn't test it? | 22:38 |
| blackburn | :D | 22:38 |
| wiking | blackburn: no :) | 22:38 |
| wiking | blackburn: as it doesn't work for me | 22:38 |
| wiking | i knew how to patch for myself | 22:38 |
| wiking | n4nd0: yeps | 22:39 |
| n4nd0 | wiking: I find it strange that you don't find a seg fault (actually it says glibc detected) when running it | 22:39 |
| wiking | n4nd0: lol?! | 22:39 |
| wiking | n4nd0: it ran smoothly for me | 22:39 |
| n4nd0 | wiking: aham | 22:39 |
| n4nd0 | there is a bug in any case :) | 22:39 |
| wiking | n4nd0: although it at shitload amount of memory | 22:39 |
| wiking | *ate | 22:40 |
| n4nd0 | wiking: what? | 22:40 |
| n4nd0 | oh sorry, ok | 22:40 |
| wiking | so it used like 1.2G ram | 22:40 |
| wiking | or so | 22:40 |
| n4nd0 | yes, I am trying to fix now the mem leaks | 22:40 |
| n4nd0 | there are some still here | 22:40 |
| wiking | heheh go for it | 22:40 |
| wiking | blackburn: so which static analyzer then? | 22:40 |
| blackburn | wiking: no idea, I didn't try others | 22:41 |
| n4nd0 | wiking: but you can check the bug I am telling you, Mosek.cpp:241 | 22:41 |
| wiking | n4nd0: lemme see | 22:41 |
| CIA-21 | shogun: Sergey Lisitsyn openmp * r74a774c / : Merge remote-tracking branch 'origin/openmp' into openmp (+530 more commits...) - http://git.io/cBWwMg | 22:41 |
| n4nd0 | wiking: when A.num_rows = 0 (the constraints matrix A is empty) that is not valid | 22:41 |
| n4nd0 | ptr[A.num_rows-1] ... | 22:42 |
| n4nd0 | I am taking care of this so don't bother fixing it right now | 22:42 |
| wiking | okok | 22:42 |
| wiking | not touching anything :) | 22:42 |
| n4nd0 | :) | 22:42 |
| wiking | not even the lousy mosek detection in ./configure script | 22:43 |
| wiking | ;) | 22:43 |
| n4nd0 | hehe | 22:44 |
| n4nd0 | sorry about that :( | 22:44 |
| wiking | nw :) | 22:44 |
| n4nd0 | didn't do anything for auto-detect mosek with configure | 22:44 |
| blackburn | no mosek no cry | 22:45 |
| wiking | :) | 22:46 |
| shogun-buildbot_ | build #367 of deb3 - modular_interfaces is complete: Failure [failed test python_modular] Build details are at http://www.shogun-toolbox.org/buildbot/builders/deb3%20-%20modular_interfaces/builds/367 blamelist: Sergey Lisitsyn <lisitsyn.s.o@gmail.com> | 22:49 |
| shogun-buildbot_ | build #356 of deb1 - libshogun is complete: Failure [failed git] Build details are at http://www.shogun-toolbox.org/buildbot/builders/deb1%20-%20libshogun/builds/356 blamelist: Evgeniy Andreev <gsomix@gmail.com>, Sergey Lisitsyn <lisitsyn.s.o@gmail.com> | 22:51 |
| blackburn | I do not understand what happens with data | 22:52 |
| wiking | :) | 22:53 |
| -!- gsomix_ is now known as gsomix | 22:53 | |
| wiking | blackburn: it's ok now | 23:02 |
| wiking | i mean the data... | 23:03 |
| blackburn | nice | 23:11 |
| -!- nonoelph12345 [~user@cpc1-benw6-0-0-cust262.gate.cable.virginmedia.com] has joined #shogun | 23:20 | |
| n4nd0 | leaks out in so_multiclass :) | 23:23 |
| CIA-21 | shogun: Sergey Lisitsyn master * r89a4836 / (2 files in 2 dirs): Fixed serialization issue - http://git.io/OambAg | 23:27 |
| shogun-buildbot_ | build #357 of deb1 - libshogun is complete: Success [build successful] Build details are at http://www.shogun-toolbox.org/buildbot/builders/deb1%20-%20libshogun/builds/357 | 23:30 |
| -!- n4nd0 [~nando@98.Red-2-137-39.dynamicIP.rima-tde.net] has quit [Ping timeout: 246 seconds] | 23:31 | |
| -!- n4nd0 [~nando@98.Red-2-137-39.dynamicIP.rima-tde.net] has joined #shogun | 23:33 | |
| CIA-21 | shogun: Evgeniy Andreev master * ra9e8ca1 / src/interfaces/python_modular/DenseFeatures_protocols.i : removed code that requires directors - http://git.io/2yabCg | 23:35 |
| CIA-21 | shogun: Sergey Lisitsyn master * r40f88f7 / src/interfaces/python_modular/DenseFeatures_protocols.i : Merge pull request #729 from gsomix/buffer_protocol - http://git.io/BU7j1g | 23:35 |
| shogun-buildbot_ | build #293 of deb2 - static_interfaces is complete: Success [build successful] Build details are at http://www.shogun-toolbox.org/buildbot/builders/deb2%20-%20static_interfaces/builds/293 | 23:36 |
| -!- n4nd0 [~nando@98.Red-2-137-39.dynamicIP.rima-tde.net] has quit [Client Quit] | 23:37 | |
| shogun-buildbot_ | build #368 of deb3 - modular_interfaces is complete: Failure [failed compile python_modular] Build details are at http://www.shogun-toolbox.org/buildbot/builders/deb3%20-%20modular_interfaces/builds/368 blamelist: Sergey Lisitsyn <lisitsyn.s.o@gmail.com> | 23:40 |
| shogun-buildbot_ | build #369 of deb3 - modular_interfaces is complete: Failure [failed compile ruby_modular] Build details are at http://www.shogun-toolbox.org/buildbot/builders/deb3%20-%20modular_interfaces/builds/369 blamelist: Evgeniy Andreev <gsomix@gmail.com>, Sergey Lisitsyn <lisitsyn.s.o@gmail.com> | 23:54 |
| --- Log closed Fri Aug 17 00:00:17 2012 | ||
Generated by irclog2html.py 2.10.0 by Marius Gedminas - find it at mg.pov.lt!